|
Staphylococcus epidermidis
Multilocus sequence typing of Staphylococcus epidermidis
Introduction
PCR Conditions and Sequencing
Determining Allelic Numbers and Sequence Types
Comparison of Isolates With the S. epidermidis Isolate Database
Submitting Strain Information
Database Curation
References
Introduction
S. epidermidis has become a leading cause of nosocomial infections. Its ability to produce a thick, multilayered biofilm allows S. epidermidis to colonise polymer surfaces and consequently a wide range of implanted medical devices, while also providing a degree of resistance to both antibiotics and the host's immune system. Therefore, while not possessing the wide range of toxins and virulence factors of its close relative, S. aureus, S. epidermidis remains a clinically important pathogen.
Three MLST schemes were previously available for S. epidermidis, two of which were published during the same month by Wang et al and Wisplinghoff et al, while the third scheme, developed by Peacock et al was unpublished. However, the uptake of these schemes proved to be lower than expected, possibly due to the poor resolution achieved during their use. In a comparison of the three MLST schemes using the same isolate collection by Thomas et al, none of the schemes was found to be more discriminatory than any of the others. This led to the development of the unified and improved MLST scheme for S. epidermidis, which utilised the most discriminatory loci from the three available MLST schemes.
The unified MLST scheme employs the internal fragments of arcC and aroE from the Wisplinghoff et al MLST scheme, gtr, mutS and pyrR loci from the Peacock et al MLST scheme and sequences from the tpiA and yqiL genes used by the Wang et al MLST scheme.
Thomas JC, Vargas MR, Miragaia M, Peacock SJ, Archer GL and Enright MC. 2007. Improved Multilocus Sequence Typing Scheme for Staphylococcus epidermidis. J Clin Microbiol. 45(2): 616-619
[Top of page]
PCR Conditions and Sequencing
Internal fragments of the seven loci can be amplified by PCR, using the primers
listed below and chromosomal DNA as a template. PCR involved an initial denaturation
of 95°C for 3 min; 34 cycles of 95°C for 30 s, 50°C for 1 min, and 72°C for
1 min; and a final extension of 72°C for 10 min.
| Genes and Function |
Sequences
(5'-3') |
Size of amplicon
used for assigning alleles |
| Carbamate Kinase (arcC) |
|
|
| arcC-F |
TGTGATGAGCACGCTACCGTTAG |
465 |
| arcC-R |
TCCAAGTAAACCCATCGGTCTG |
|
| |
|
|
| Shikimate dehydrogenase (aroE) |
|
|
| aroE-F |
CATTGGATTACCTCTTTGTTCAGC |
420 |
| aroE-R |
CAAGCGAAATCTGTTGGGG |
|
| |
|
|
| ABC transporter (gtr) |
|
|
| gtr-F |
CAGCCAATTCTTTTATGACTTTT |
438 |
| gtr-R |
GTGATTAAAGGTATTGATTTGAAT |
|
| |
|
|
| DNA mismatch repair protein (mutS) |
|
|
| mutS-F3 |
GATATAAGAATAAGGGTTGTGAA |
412 |
| mutS-R3 |
GTAATCGTCTCAGTTATCATGTT |
|
| |
|
|
| Pyrimidine operon regulatory protein (pyrR) |
|
|
| pyr-F2 |
GTTACTAATACTTTTGCTGTGTTT |
428 |
| pyr-R4 |
GTAGAATGTAAAGAGACTAAAATGAA |
|
| |
|
|
| Triosephosphate isomerase (tpiA) |
|
|
| tpi-F2 |
ATCCAATTAGACGCTTTAGTAAC |
424 |
| tpi-R2 |
TTAATGATGCGCCACCTACA |
|
| |
|
|
| Acetyl coenzyme A acetyltransferase (yqiL) |
|
|
| yqiL-F2 |
CACGCATAGTATTAGCTGAAG |
416 |
| yqiL-R2 |
CTAATGCCTTCATCTTGAGAAATAA |
|
| |
|
|
Sequences for each locus must be obtained for both the forward and reverse
strands, and must be 100% accurate, since even a single error will alter the
allelic number obtained and may even convert a known allele into a novel allele
or vice versa.
[Top of page]
Determining
Allelic Numbers and Sequence Types
Sequences must be trimmed in order to correspond precisely to the region used
to define the locus. A sequence for each locus is available at the following
links:
arcC |
aroE |
gtr |
mutS |
pyrR |
tpiA |
yqiL
and can be used to ensure that your sequences have been
trimmed correctly.
In order to determine the allelic number for a locus, select the Staphylococcus
epidermidis database, and the relevant locus query choice, depending on whether
the sequences intended to be submitted are for a single locus, several loci of
the same isolate (select multiple locus), or multiple alleles of the same locus
(select batch). Sequences can then be cut and pasted into the corresponding fields
and submitted.
The software will check that the sequences are the correct length and that they
do not contain any unrecognised characters. A check is also made to see if the
submitted sequence is at least 70% similar to another allele at that locus (in
case a sequence has been cut and pasted into the wrong box).
[Top of page]
Comparison of Isolates With the S. epidermidis Isolate Database
Details of isolates that are identical to the one submitted may be available from the S. epidermidis isolate database (from the profile query dropdown menu, select database query. Select ST from one of the id dropdown menus, and enter the sequence type of the isolate in the adjacent field). Following analysis of the allelic profile with eBURST in conjunction with the entire S. epidermidis database, it will be possible to ascertain which sequence types are closely related to the isolate being studied. This will allow the user to query the S. epidermidis database for details of these closely related isolates using the same procedure as that for the initial isolate. For example, isolates with an allelic profile that display at least 4/7, 5/7 or 6/7 loci that are identical to the submitted allelic profile, may be investigated. However, it should be noted that the "running eBURST on the entire Staphylococcus epidermidis database", or adding "your allelic profiles to a list of all isolate profiles in the database" options available via eBURST will include only the sequence types of those isolates in the S. epidermidis database, and not examples of all known sequence types
Further details about strains that are identical, or similar, to the submitted strain can be obtained by clicking on the strain names.
[Top of page]
Submitting Strain Information
Investigators are strongly encouraged to submit sequence type and strain information for all isolates characterized by the unified S. epidermidis MLST scheme and not only those that represent novel sequence types. The isolate database should prove to be more effective and valuable as a research tool if information on as many isolates as possible is included.
To submit information on isolates with previously reported sequence types, a template excel form is available. This form can be obtained from the database curator.
[Top of page]
Database Curation
The S. epidermidis MLST database is currently curated by Jonathan Thomas.
Please direct all enquires to the database curator:
Jonathan Thomas
(jonathan.thomas@yale.edu)
[Top of page]
References
Thomas JC, Vargas MR, Miragaia M, Peacock SJ, Archer GL and Enright MC. 2007. Improved Multilocus Sequence Typing Scheme for Staphylococcus epidermidis. J Clin Microbiol. 45(2): 616-619
Wang XM, Noble L, Kreiswirth BN, Eisner W, McClements W, Jansen KU and Anderson AS. 2003. Evaluation of a multilocus sequence typing system for Staphylococcus epidermidis. J Med Microbiol. 52(11): 989-98
Wisplinghoff H, Rosato AE, Enright MC, Noto M, Craig W and Archer GL. 2003. Related clones containing SCCmec type IV predominate among clinically significant Staphylococcus epidermidis isolates. Antimicrob Agents Chemother. 47(11): 3574-9
|